0

1 ora 16596 database is not a member of the data guard configuration

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo khoa học

... with the recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site ... mutagenesis was then conducted in order to identify the catalytic His residue of the C1 catalytic triad Analysis of hydrophobicity plots of the Phl p amino-acid sequence (data not shown) indicated that ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated  15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...
  • 10
  • 535
  • 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

Ngân hàng - Tín dụng

... into a bank party and an anti-bank party, and the struggle was severe In 1785, the anti-bank party prevailed in the legislature, and the bank charter was repealed; The History of Banks/29 but the ... fixed at half their former rate A like reduction was simultaneously to take place in the rated value of the stock of the company This edict was instantly fatal to the circulation of the notes Apart ... the case of a merely private partnership, are rapidly displacing the private banks They have already excited the serious jealousy of the Bank of England; and there are strong indications, that...
  • 78
  • 775
  • 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo khoa học

... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... Activity measured in 33 mM sodium phosphate, pH 7.0 Fig Analysis of the deletion of ADH6 and ADH7 genes Agarose gel of genomic DNA of the yeast strains BJ2168: ADH6 ADH7, lanes and 2; BJ18: adh6D ... eluted from the size exclusion chromatography (Fig 1A) The native molecular mass of the enzyme, estimated by this last chromatography, was 81 kDa (data not shown) Consequently, the enzyme is a homodimer...
  • 8
  • 378
  • 0
Báo cáo y học:

Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Báo cáo khoa học

... with the traumatised person The first aider should speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as a superior ... was small, particularly the carers' panel It may be that some carers were not present at the time of the traumatic event, or may not feel that they have any expertise, Kelly et al BMC Psychiatry ... professional help if they are unable to enjoy life at all as a result of the trauma for weeks or more The first aider should be aware of the sorts of professional help which are available If the person...
  • 15
  • 342
  • 0
the subsidy regulations and vietnam’s position as a member of the wto

the subsidy regulations and vietnam’s position as a member of the wto

Khoa học xã hội

... anti-subsidy on the export of sugar cane between Australia, Brazil, and Thailand and the EC55 and between Brazil, Australia, Canada, China, India, Thailand and Japan and the US in the cotton case.56 WT/DS267 ... classed as financial contributions even though they are not within the strict meaning of the term.21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... international trade is is also considered In the second part covers the subsidy regulations and anti-subsidy of the WTO and of Vietnam The SCM Agreement and the AoA of the WTO were used in analysing the...
  • 59
  • 314
  • 0
Báo cáo y học:

Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx

Báo cáo khoa học

... by: Howley DMKaPM Philadelphia: Lippincott Williams & Wilkins; 2007:795-838 Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Isomura S: Isolation of cytopathic small round viruses ... enteric pathogens using routine enzyme immunoassays (EIA) and culture assays for rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays ... with acute diarrhea between 1978 and 1999 For a portion of these samples (70), RNA was extracted in the same manner as the primary sample For the remaining specimens (73), chips of frozen fecal...
  • 7
  • 328
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx

Báo cáo khoa học

... by: Howley DMKaPM Philadelphia: Lippincott Williams & Wilkins; 2007:795-838 Yamashita T, Kobayashi S, Sakae K, Nakata S, Chiba S, Ishihara Y, Isomura S: Isolation of cytopathic small round viruses ... enteric pathogens using routine enzyme immunoassays (EIA) and culture assays for rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays ... with acute diarrhea between 1978 and 1999 For a portion of these samples (70), RNA was extracted in the same manner as the primary sample For the remaining specimens (73), chips of frozen fecal...
  • 7
  • 583
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Báo cáo khoa học

... measure the lag-phase of the reaction, i.e the time before an apparent increase in absorbance of 0.1 was recorded The addition of PDI to the assay accelerated the reduction and precipitation of ... other thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated ... rates of catalysis, and neither showed any change in activity upon the addition of bacitracin (P > 0.5) For further study of the potential mechanism of action, the reaction conditions of the assay...
  • 9
  • 620
  • 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học

... of Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted ... osmotic stress and starvation Although the TrichoEST database comprises ESTs of several Hypocrea ⁄ Trichoderma species, and the genome database of H jecorina is available, it was impossible to ... a distance algorithmic method Stability of clades was evaluated by 1000 bootstrap rearrangements Bootstrap values lower than 20% are not displayed in the cladogram RNA isolation and hybridization...
  • 14
  • 494
  • 0
''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf

''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf

Chụp ảnh - Quay phim

... of the game than in the game play itself; the unfolding of the answers IS the narrative that has me hooked… a meta-narrative" [20] In another editorial "Meta Mystery," Maria Bonasia, a twentysomething ... stated) and legal disclaimers All of this peripheral information serves as a constant reminder that a game is being played Another barrier to player immersion in the Nokia Game is its reliance on ... and viscerally to the needs and demands of each other and of the fictional world This kind of belief demonstrated the capacity to provoke action, as many Cloudmakers acted in-game on the behalf...
  • 10
  • 583
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc

Báo cáo khoa học

... aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ... verified by a computer program accompanying this paper We include here a rigorous, mathematical proof of this fact not relying on the computer verification Head Grammars A head grammar is a quadruple ... tree for aa¯ aa¯ #¯ a aaa a a a a The following lemma should be intuitively clear from the definition of a derivation tree: D(ε, ε) ← Lemma Let G = (N, Σ, P, S) be a head grammar and A be a nonterminal...
  • 9
  • 374
  • 0
odysseus is not a hero

odysseus is not a hero

Kỹ năng viết tiếng Anh

... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... crew members killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...
  • 2
  • 408
  • 0
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học

... hypoxia for 36 h, with sense primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢ The PCR product was ligated to pGEM-T (Promega) ... Manitoba Central Animal Care breeding facility All procedures followed Canadian Council on Animal Care guidelines and were approved by the Animal Care Committee at the University of Manitoba Animals ... neuronal apoptosis in excitotoxicity Results Kainic acid (KA) is a specific agonist for the kainate receptor (a subtype of the ionotrophic glutamate receptor) that mimics the effect of glutamate Of the...
  • 9
  • 388
  • 0
Đề tài

Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Thạc sĩ - Cao học

... all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the reduced ... Gaussian random variables with mean value and vari*This work was carried out, while the first author was a member of the MaPhySto – Centre for Mathematical Physics and Stochastics, funded by the ... ) is a random variable taking values in Er,n , so that Y = Ψ(X) is a random variable taking values in Rrn As mentioned in Remark 3.4, it is easily seen that the distribution of Y on Rrn is the...
  • 66
  • 378
  • 0
This pdF is a sample of the trend database & Monthly Snapshot potx

This pdF is a sample of the trend database & Monthly Snapshot potx

Cơ sở dữ liệu

... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... TREND DATABA SE SA MPLE trend watching com PREMIUM 1.1 TREND DATABASE » PREMIUM GATEWAY M SA E PL w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.2 TREND DATABASE ... DATABASE » TREND DATABASE M SA E PL Keyword search the Database Filter trend examples by industry by trends, industries & time Full list of Trends Full list of Industries w w w.t r en d w a t...
  • 27
  • 325
  • 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo khoa học

... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... domain (Fig 7B) DISCUSSION There is mounting evidence that inflammatory cell infiltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue ... searching a proprietary EST database (Incyte, Palo Alto, CA, USA) for gene sequences that exhibit elevated expression in diseased immune tissues A total of 995 libraries containing a total of...
  • 14
  • 540
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

Báo cáo khoa học

... Statistical Analysis For a statistical analysis, a Student’s t-test for normally distributed data and the Mann Whitney U-test for skewed data were used The percentage was analyzed using a Chisquare ... Osaka city, Osaka 540-0006 Japan Department of Radiation Oncology, Osaka University Graduate School of Medicine, Yamadaoka 2-2, Suita, 565-0871 Osaka, Japan 4Department of Maxillo-Facial Radiology, ... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S,...
  • 7
  • 367
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa học

... of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA in the sample Authors' contributions Heather Jaspan conceived of the ... each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across at least three reactions in which approximately equal amounts of sample and ... serially diluted Known concentrations of the competitor cDNA was amplified in the same reaction tube as unknown amounts of sample derived RT-cDNA This cDNA was obtained as follows Total RNA is...
  • 4
  • 319
  • 0
Báo cáo y học:

Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx

Báo cáo khoa học

... this particular patient group Author contributions TMV participated in the design of the study, data collection, data analysis and writing of the manuscript JHDV participated in data analysis and ... writing of the manuscript JBH participated in the design of the study, data collection, data analysis and writing of the manuscript FH participated in the design of the study and writing of the manuscript ... outcome Logistic regression analysis was used for infectious complications, and linear regression analysis was used for length of stay Because of nonparametric distribution, length of stay data were...
  • 6
  • 368
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose